Top » Catalog » SNPs » FGC87927

$18.00

FGC87927
[FGC87927]

FGC87927
hg38 Position: ChrY:13649948..13649948
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC87927_F AATTTTAGAATAAGTGCAATGTGGTTG
Reverse Primer: FGC87927_R AAAGAAAGACATTACATAATGGTAAAGGC
Reviews

Customers who bought this product also purchased
FGC87926
FGC87926
BY81893
BY81893
BY53798
BY53798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies