Top » Catalog » SNPs » BY74

$18.00

BY74
[BY74]

BY74
hg38 Position: ChrY:6895193..6895193
Ancestral: A
Derived: G
Reference: FTDNA
ISOGG Haplogroup: J1a (not listed)
Comments: Below Z640
Forward Primer: BY74_F GAAAATCTAGATAGACACCAACAAAAGC
Reverse Primer: BY74_R GTAAGGAGTCCTTGATGTCTTGC
Reviews

Customers who bought this product also purchased
CTS11754
CTS11754
FT133907
FT133907
BY123351
BY123351
FGC54385
FGC54385
FGC30548
FGC30548
ZS9000
ZS9000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies