Top » Catalog » SNPs » BY74

$18.00

BY74
[BY74]

BY74
hg38 Position: ChrY:6895193..6895193
Ancestral: A
Derived: G
Reference: FTDNA
ISOGG Haplogroup: J1a (not listed)
Comments: Below Z640
Forward Primer: BY74_F GAAAATCTAGATAGACACCAACAAAAGC
Reverse Primer: BY74_R GTAAGGAGTCCTTGATGTCTTGC
Reviews

Customers who bought this product also purchased
Y72854
Y72854
ZS1426
ZS1426
BY92
BY92
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC59116
FGC59116
FGC59170
FGC59170
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies