Top » Catalog » SNPs » BY207040

$18.00

BY207040
[BY207040]

BY207040
hg38 Position: ChrY:13499040..13499040
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below Z3004/FGC41929
Forward Primer: BY207040_F TCAGCATAAACAGCCAAAAGC
Reverse Primer: BY207040_R AGGGGAGGCTTGATGAAAAC
Reviews

Customers who bought this product also purchased
BY207893
BY207893
BY205684
BY205684
Wish a SNP
Wish a SNP
BY208661
BY208661
BY208294
BY208294
BY208025
BY208025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies