Top » Catalog » SNPs » BY208025

$18.00

BY208025
[BY208025]

BY208025
hg38 Position: ChrY:17164957..17164957
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below Z3004/FGC41929
Forward Primer: BY208025_F ATATAAATTGTCCACTTAATTAGATGCCTG
Reverse Primer: BY208025_R TTGTAGTTTAAACATTTTATTTTCAGGGAG
Reviews

Customers who bought this product also purchased
BY208294
BY208294
BY207893
BY207893
BY207040
BY207040
BY205684
BY205684
Wish a SNP
Wish a SNP
BY208661
BY208661
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies