Top » Catalog » SNPs » BY208294

$18.00

BY208294
[BY208294]

BY208294
hg38 Position: ChrY:19448646..19448646
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below Z3004/FGC41929
Forward Primer: BY208294_F AACTGGAGGGAGAAAGTCAAAGAC
Reverse Primer: BY208294_R AATCGGGAGTTCTGAATACCG
Reviews

Customers who bought this product also purchased
BY208661
BY208661
BY208025
BY208025
BY207893
BY207893
BY207040
BY207040
BY205684
BY205684
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies