Top » Catalog » SNPs » BY192625

$18.00

BY192625
[BY192625]

BY192625
hg38 Position: ChrY:13655661..13655661
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY192625_F TTGCAACCCCTTTCCATTAG
Reverse Primer: BY192625_R AAGGCTTCCCATGTTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies