Top » Catalog » SNPs » MZ279

$18.00

MZ279
[MZ279]

MZ279
hg38 Position: ChrY:16448204..16448204
Ancestral: C
Derived: T
Reference: Hamma Bachir (2019)
ISOGG Haplogroup: E1b
Comments: Downstream of Z5009
Forward Primer: MZ279_F CCTTCTGTGTTTGTCCAGAGG
Reverse Primer: MZ279_R GAAGGCTGTGACTTGCCAC
Reviews

Customers who bought this product also purchased
M5043
M5043
BY9698
BY9698
BY9699
BY9699
MZ90
MZ90
M81
M81
Y128375
Y128375
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies