Top » Catalog » SNPs » BY97555

$18.00

BY97555
[BY97555]

BY97555
hg38 Position: ChrY:12668555..12668555
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below S17250 > PH908
Forward Primer: BY97555_F GGCCCAGAAAGTTGAGACAG
Reverse Primer: BY97555_R GTCCCAACTTTATGGGATGG
Reviews

Customers who bought this product also purchased
FT138628
FT138628
PH908
PH908
A5913
A5913
FT169314
FT169314
S17250
S17250
Y183467
Y183467
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies