Top » Catalog » SNPs » S15852

$18.00

S15852
[S15852]

S15852
hg38 Position: ChrY:12219571..12219571
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1
Comments: Below ZS10317
Forward Primer: S15852_F TCCTCAGCCTCCTGAGTAGC
Reverse Primer: S15852_R AGTCGATGCCAGAGTGAACC
Reviews

Customers who bought this product also purchased
BY75
BY75
ZS2373
ZS2373
V1662
V1662
ZS2374
ZS2374
ZS10316
ZS10316
J1-ZS2374 Panel
J1-ZS2374 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies