Top » Catalog » SNPs » FGC43126

$19.00

FGC43126
[FGC43126]

FGC43126
hg38 Position: ChrY:17234820..17234820
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Below Y5321 > Y5324 > Y5322 > Y9271 > Y5323 > Y5320
Forward Primer: FGC43126_F TATTCCCCAGGATGTACTGCAG
Reverse Primer: FGC43126_R GCACATCCTGCACCTGTACTC
Reviews

Customers who bought this product also purchased
FGC1721
FGC1721
FGC49889
FGC49889
FT394138
FT394138
Y20903
Y20903
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
FGC4
FGC4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies