Top » Catalog » SNPs » A3069

$18.00

A3069
[A3069]

A3069
hg38 Position: ChrY:12078175..12078175
Ancestral: T
Derived: A
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3069_F ACATATACACACACAAATATATTTGTACCG
Reverse Primer: A3069_R ATAATTTGACCCCATTTAGATGATTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies