Top » Catalog » SNPs » BY32847

$18.00

BY32847
[BY32847]

BY32847
hg38 Position: ChrY:3046037..3046037
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below BY32850 > BY32851
Forward Primer: BY32847_F GGGCAGTAAGCTCCTGGC
Reverse Primer: BY32847_R CAGCAGAGTGGGTTGAAGGTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies