Top » Catalog » SNPs » CTS4431

$18.00

CTS4431
[CTS4431]

CTS4431
hg38 Position: ChrY:13529963..13529963
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Y3183
Forward Primer: CTS4431_F GGACTGTTGTGGTGTGGGC
Reverse Primer: CTS4431_R TGGCAGGGTGTGAGACTATTG
Reviews

Customers who bought this product also purchased
M35.2
M35.2
Z16661
Z16661
Z5018
Z5018
A7136
A7136
E1b-V13 Panel
E1b-V13 Panel
Y3183
Y3183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies