Top » Catalog » SNPs » CTS4431

$18.00

CTS4431
[CTS4431]

CTS4431
hg38 Position: ChrY:13529963..13529963
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Y3183
Forward Primer: CTS4431_F GGACTGTTGTGGTGTGGGC
Reverse Primer: CTS4431_R TGGCAGGGTGTGAGACTATTG
Reviews

Customers who bought this product also purchased
FGC11457
FGC11457
S2979
S2979
S2972
S2972
M35.2
M35.2
Z16661
Z16661
Z5018
Z5018
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies