Top » Catalog » SNPs » BY153266

$18.00

BY153266
[BY153266]

BY153266
hg38 Position: ChrY:10626673..10626673
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: Below V13 > Z5017 > Z16988 > BY155589
Forward Primer: BY153266_F TAGTTTTTATGTGAAGATAGTTTCTTTTCACC
Reverse Primer: BY153266_R ACGGAATGGAATGGAATGTTG
Reviews

Customers who bought this product also purchased
BY155810
BY155810
BY154051
BY154051
BY153593
BY153593
BY153053
BY153053
BY195200
BY195200
E1b Bjelopavlići Clan Panel
E1b Bjelopavlići Clan Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x P216
1 x A22312
$36.00
Haplogroup Info
Other products
Currencies