Top » Catalog » SNPs » BY195200

$18.00

BY195200
[BY195200]

BY195200
hg38 Position: ChrY:15760127..15760127
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5017 > Z16988 > BY155589
Forward Primer: BY195200_F TCTTGATGAAGTACCTTAGCACAGC
Reverse Primer: BY195200_R CGAACCACATGAAAACATGG
Reviews

Customers who bought this product also purchased
BY153053
BY153053
BY193806
BY193806
E1b Bjelopavlići Clan Panel
E1b Bjelopavlići Clan Panel
BY155810
BY155810
BY154051
BY154051
BY153593
BY153593
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies