Top » Catalog » SNPs » FT13423

$18.00

FT13423
[FT13423]

FT13423
hg38 Position: ChrY:15140483..15140483
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT13423_F AGGAGGGAGAGCAGACACAC
Reverse Primer: FT13423_R CCTTTACTGGTTGGGTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies