Top » Catalog » SNPs » A24170

$18.00

A24170
[A24170]

A24170
hg38 Position: ChrY:19211706..19211706
Ancestral: C
Derived: A
Reference: Armando Framarini( 2019)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A24170_F TGTGTCTAAAGTTTTTAAATACACTGG
Reverse Primer: A24170_R AGGAGAAAATAAAAGAGAGATCAAAATAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies