Top » Catalog » SNPs » A24172

$18.00

A24172
[A24172]

A24172
hg38 Position: ChrY:2803388..2803388
Ancestral: A
Derived: C
Reference: Armando Framarini( 2019)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A24172_F GCTTGTTTTTATCAGGTTTGCTG
Reverse Primer: A24172_R GATTTCTATACACCAACAATGGACAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies