Top » Catalog » SNPs » A24174

$18.00

A24174
[A24174]

A24174
hg38 Position: ChrY:10164588..10164588
Ancestral: A
Derived: G
Reference: Armando Framarini( 2019)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A24174_F CATGTTTTTCCAGTGGATGG
Reverse Primer: A24174_R TTGGAAAACAATCAGCAGGATATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies