Top » Catalog » SNPs » A24178

$18.00

A24178
[A24178]

A24178
hg38 Position: ChrY:16100446..16100446
Ancestral: A
Derived: G
Reference: Armando Framarini( 2019)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A24178_F CACATGTTTGATTGCTGTACGG
Reverse Primer: A24178_R CCTGTCATTATGATGCTAGCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies