Top » Catalog » SNPs » BY183199

$18.00

BY183199
[BY183199]

BY183199
hg38 Position: ChrY:14579678..14579678
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY183199_F GGGTAGAAGGCTTAGTTCAGGAG
Reverse Primer: BY183199_R CTTCTCTCCTTCAAATATCTTCTTGATATTAC
Reviews

Customers who bought this product also purchased
FGC53809
FGC53809
Mail Tracking
Mail Tracking
BY183038
BY183038
DNA Sample Kit
DNA Sample Kit
FGC53804
FGC53804
DYR33
DYR33
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies