Top » Catalog » SNPs » Y876

$18.00

Y876
[Y876]

Y876
hg38 Position: ChrY:13186941..13186941
Ancestral: C
Derived: A
Reference: Lawrence Mayka (2013)
ISOGG Haplogroup: not listed
Comments: Below Z2123
Forward Primer: Y876_F AGTAGGGGCCAACAGACACC
Reverse Primer: Y876_R TCCTTGCAATGGGGTAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies