Top » Catalog » SNPs » A24185

$18.00

A24185
[A24185]

A24185
hg38 Position: ChrY:13380301..13380301
Ancestral: G
Derived: T
Reference: Jacques STUART (2019)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A24185_F GAGCAAGGATCAGAACCAAAC
Reverse Primer: A24185_R TCTGCCTGGTGTTCTGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies