Top » Catalog » SNPs » A24187

$18.00

A24187
[A24187]

A24187
hg38 Position: ChrY:17069982..17069982
Ancestral: A
Derived: C
Reference: Jacques STUART (2019)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A24187_F AAGCTAGCCCCAAAGATAGTG
Reverse Primer: A24187_R TGTGCCCCACACACTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies