Top » Catalog » SNPs » Y71347

$18.00

Y71347
[Y71347]

Y71347
hg38 Position: ChrY:15152972..15152972
Ancestral: A
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: I2
Comments: DYS718
Forward Primer: Y71347_F AAGAACAAACAAAATCCATATGTAAGAC
Reverse Primer: Y71347_R TGGCACATATATACCATGGATTACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies