Top » Catalog » SNPs » A24191

$18.00

A24191
[A24191]

A24191
hg38 Position: ChrY:15138664..15138664
Ancestral: G
Derived: T
Reference: Ed Aber Leek (2019)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z16267 > Z3000 > Z3004 > FGC41930
Forward Primer: A24191_F TCTGCCTTCTACATAGCAGTAGCAG
Reverse Primer: A24191_R CTCTGAGTATATATCCAGTAAGAGGATTGC
Reviews

Customers who bought this product also purchased
BY178014
BY178014
A24193
A24193
A24192
A24192
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies