Top » Catalog » SNPs » FT2962

$18.00

FT2962
[FT2962]

FT2962
hg38 Position: ChrY:13387075..13387075
Ancestral: T
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below Y17214
Forward Primer: FT2962_F GAGGAGGAGGTTGCAGTGAG
Reverse Primer: FT2962_R TCTTCTTCCCTCTGCCTCTAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies