Top » Catalog » SNPs » A24201

$18.00

A24201
[A24201]

A24201
hg38 Position: ChrY:14861485..14861485
Ancestral: C
Derived: A
Reference: Joshua Kelley (2019)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A24201_F GGTGCAATCAAATTAGAACTCAG
Reverse Primer: A24201_R CTTTTCAAAGCTGTCAGCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies