Top » Catalog » SNPs » FT14506

$18.00

FT14506
[FT14506]

FT14506
hg38 Position: ChrY:15387752..15387752
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Bellow PH908
Forward Primer: FT14506_F GAGGTCTAGGCCTTGGTGC
Reverse Primer: FT14506_R CTAATAATTGGTCTGCTCAAATGC
Reviews

Customers who bought this product also purchased
FT277419
FT277419
Z16983
Z16983
PH3314
PH3314
PH3310
PH3310
Y30726
Y30726
S10860
S10860
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies