Top » Catalog » SNPs » FT14506

$18.00

FT14506
[FT14506]

FT14506
hg38 Position: ChrY:15387752..15387752
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Bellow PH908
Forward Primer: FT14506_F GAGGTCTAGGCCTTGGTGC
Reverse Primer: FT14506_R CTAATAATTGGTCTGCTCAAATGC
Reviews

Customers who bought this product also purchased
A10230
A10230
Y140541
Y140541
Y15928
Y15928
Y11772
Y11772
A2423
A2423
A14798
A14798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies