Top » Catalog » SNPs » FT14506

$18.00

FT14506
[FT14506]

FT14506
hg38 Position: ChrY:15387752..15387752
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Bellow PH908
Forward Primer: FT14506_F GAGGTCTAGGCCTTGGTGC
Reverse Primer: FT14506_R CTAATAATTGGTCTGCTCAAATGC
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
Y262291
Y262291
Y48599
Y48599
FT355524
FT355524
BY125046
BY125046
FT355750
FT355750
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies