Top » Catalog » SNPs » FT21353

$18.00

FT21353
[FT21353]

FT21353
hg38 Position: ChrY:12304600..12304600
Ancestral: T
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Bellow PH908
Forward Primer: FT21353_F GTTCAACATGGAGGCTCCAC
Reverse Primer: FT21353_R TTCAAGTGATTCTACTGCCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies