Top » Catalog » SNPs » Y140197

$18.00

Y140197
[Y140197]

Y140197
hg38 Position: ChrY:12818909..12818909
Ancestral: G
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y140197_F GGTGTCCTAAGACACCTTCAGG
Reverse Primer: Y140197_R TTGCTCAGGCTGGAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies