Top » Catalog » SNPs » BY189748

$18.00

BY189748
[BY189748]

BY189748
hg38 Position: ChrY:6991209..6991209
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y189804
Forward Primer: BY189748_F TCCTTTTGACCATGCAGAAATC
Reverse Primer: BY189748_R TCAGAGCTCACATCTAAGAAGAATATCC
Reviews

Customers who bought this product also purchased
S17250
S17250
BY191770
BY191770
I2a-M423 Panel
I2a-M423 Panel
BY135769
BY135769
Y56203
Y56203
FT14506
FT14506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies