Top » Catalog » SNPs » FGC38802

$18.00

FGC38802
[FGC38802]

FGC38802
hg38 Position: ChrY:15117157..15117157
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38802_F AACGATCTCAAAAGCTAACAGAAAAG
Reverse Primer: FGC38802_R TTTGTTTATGTGATGGATTACATGG
Reviews

Customers who bought this product also purchased
WGS400
WGS400
FT43969
FT43969
L858
L858
FGC7
FGC7
ZS4753
ZS4753
FT43313
FT43313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies