Top » Catalog » SNPs » FGC38802

$18.00

FGC38802
[FGC38802]

FGC38802
hg38 Position: ChrY:15117157..15117157
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38802_F AACGATCTCAAAAGCTAACAGAAAAG
Reverse Primer: FGC38802_R TTTGTTTATGTGATGGATTACATGG
Reviews

Customers who bought this product also purchased
WGS400
WGS400
FGC1707
FGC1707
FGC38809
FGC38809
FGC7936
FGC7936
ZS4756
ZS4756
L858
L858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies