Top » Catalog » SNPs » FGC38802

$18.00

FGC38802
[FGC38802]

FGC38802
hg38 Position: ChrY:15117157..15117157
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38802_F AACGATCTCAAAAGCTAACAGAAAAG
Reverse Primer: FGC38802_R TTTGTTTATGTGATGGATTACATGG
Reviews

Customers who bought this product also purchased
WGS400
WGS400
L858
L858
FT43969
FT43969
FGC7
FGC7
ZS4753
ZS4753
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies