Top » Catalog » SNPs » PH124

$18.00

PH124
[PH124]

PH124
hg38 Position: ChrY:6788511..6788511
Ancestral: C
Derived: G
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: H
Comments: .
Forward Primer: PH124_F ATGCGGCTCCCCGTGAC
Reverse Primer: PH124_R TATATACATAGTTGAGTTGAGAAGAAAACTCTAC
Reviews

Customers who bought this product also purchased
M3038
M3038
FT305975
FT305975
M2854
M2854
Z34649
Z34649
Z4507
Z4507
Z14453
Z14453
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies