Top » Catalog » SNPs » PH124

$18.00

PH124
[PH124]

PH124
hg38 Position: ChrY:6788511..6788511
Ancestral: C
Derived: G
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: H
Comments: .
Forward Primer: PH124_F ATGCGGCTCCCCGTGAC
Reverse Primer: PH124_R TATATACATAGTTGAGTTGAGAAGAAAACTCTAC
Reviews

Customers who bought this product also purchased
Z4507
Z4507
Z14453
Z14453
M82
M82
Z14456
Z14456
H-M82 Panel
H-M82 Panel
Z14437
Z14437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies