Top » Catalog » SNPs » Y169947

$18.00

Y169947
[Y169947]

Y169947
hg38 Position: ChrY:8880884..8880884
Ancestral: G
Derived: C
Reference: YFull (2019)
ISOGG Haplogroup: E1b1b1b2a1a4d2b
Comments: .
Forward Primer: Y169947_F GCTGGGGATGGTAGGAGG
Reverse Primer: Y169947_R AATGCCTGGCTAATTTTTTGTATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies