Top » Catalog » SNPs » Y33762

$18.00

Y33762
[Y33762]

Y33762
hg38 Position: ChrY:11997211..11997211
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Downstream Y4252
Forward Primer: Y33762_F AGGCCCGTAGTCACAGC
Reverse Primer: Y33762_R TCCTGTGTCTGTTCCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies