Top » Catalog » SNPs » Y33763

$18.00

Y33763
[Y33763]

Y33763
hg38 Position: ChrY:14679080..14679080
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Downstream Y4252
Forward Primer: Y33763_F TTTTTCATTTAAATTCCATGTTTCTG
Reverse Primer: Y33763_R AAATTATCTCTACCAAAATAAAAAAATATATATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies