Top » Catalog » SNPs » Y34550

$18.00

Y34550
[Y34550]

Y34550
hg38 Position: ChrY:20572528..20572528
Ancestral: T
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: I
Comments: Downstream Y4252
Forward Primer: Y34550_F CCTGGGGCTTTGTAAGGTACAC
Reverse Primer: Y34550_R TTGGCAGTTAGGCCAATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies