Top » Catalog » SNPs » A6228

$18.00

A6228
[A6228]

A6228
hg38 Position: ChrY:6814006..6814006
Ancestral: T
Derived: G
Reference: William Hartley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Below Z59 > A1914
Forward Primer: A6228_F CCCACAGTGTGATCTTAACCAG
Reverse Primer: A6228_R GCTATATGGGTTTCAGGAACCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies