Top » Catalog » SNPs » BY106029

$18.00

BY106029
[BY106029]

BY106029
hg38 Position: ChrY:14102016..14102016
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603 > FGC19785
Forward Primer: BY106029_F GGAGAAAGGGGCTTGTTTC
Reverse Primer: BY106029_R CATAAAACAGATTCCCTTAATCTAGTCTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies