Top » Catalog » SNPs » Y154921

$18.00

Y154921
[Y154921]

Y154921
hg38 Position: ChrY:14727997..14727997
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R2
Comments: .Below Y154917
Forward Primer: Y154921_F CATGGGCCTATACAACCAATC
Reverse Primer: Y154921_R AGCCATCCTAATGGATATGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies