Top » Catalog » SNPs » Y154926

$18.00

Y154926
[Y154926]

Y154926
hg38 Position: ChrY:15174294..15174294
Ancestral: G
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R2
Comments: .Below Y154917
Forward Primer: Y154926_F TCGTCACCTTATTCTGTGAATGC
Reverse Primer: Y154926_R TTTCACGGAAATTTTTGTTATGTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies