Top » Catalog » SNPs » Y154929

$18.00

Y154929
[Y154929]

Y154929
hg38 Position: ChrY:12764071..12764071
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R2
Comments: .Below Y154917
Forward Primer: Y154929_F TTTGCATGCCAGCTATGAAGTAC
Reverse Primer: Y154929_R CTCCATTTATTTTAATCAACATAAAGGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies