Top » Catalog » SNPs » Y18331

$18.00

Y18331
[Y18331]

Y18331
hg38 Position: ChrY:10015455..10015455
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y18331_F AGCTACTTGGGAGGGTTTGAG
Reverse Primer: Y18331_R GTTTTCAAAAACTACAAGAATCTCAGC
Reviews

Customers who bought this product also purchased
Y158862
Y158862
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies