Top » Catalog » SNPs » Y18331

$18.00

Y18331
[Y18331]

Y18331
hg38 Position: ChrY:10015455..10015455
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y18331_F AGCTACTTGGGAGGGTTTGAG
Reverse Primer: Y18331_R GTTTTCAAAAACTACAAGAATCTCAGC
Reviews

Customers who bought this product also purchased
BY116090
BY116090
BY190177
BY190177
A1221
A1221
FGC12095
FGC12095
YP196
YP196
FT256413
FT256413
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies