Top » Catalog » SNPs » Y18331

$18.00

Y18331
[Y18331]

Y18331
hg38 Position: ChrY:10015455..10015455
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y18331_F AGCTACTTGGGAGGGTTTGAG
Reverse Primer: Y18331_R GTTTTCAAAAACTACAAGAATCTCAGC
Reviews

Customers who bought this product also purchased
B57
B57
Y161695
Y161695
Y3118
Y3118
Y25010
Y25010
A6036
A6036
S2679
S2679
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies